MicroRNA-183 regulates Ezrin expression in lung cancer cells

Abstract

Lung cancer is the leading cause of cancer death. However, the mechanism of lung cancer relapse and metastasis has been poorly elucidated. Recent researches have addressed the role of MicroRNAs (miRNAs) in mediating tumor metastasis. In the present study, we identified microRNA-183 (miR-183) as a potential metastasis-inhibitor. Expression level of miR-183 was reversely correlated with the metastatic potential of lung cancer cells. Furthermore, over-expression of miR-183 inhibited migration and invasion of lung cancer cells. Mechanistically, we identified VIL2-coding-protein Ezrin as a bona fide target of miR-183. We also found that miR-183 could regulate the expression of other genes involved in migration and invasion. Taken together, our findings demonstrated a new role and regulatory mechanism of miR-183 in controlling cancer metastasis.

1 Introduction

Lung cancer, the leading cause of cancer deaths, has the most rapidly increasing incidence rate in the developed country as well as in China [1, 2]. Clinical data have showed that most lung cancer patients eventually suffered relapse and/or metastasis after complete excision of the cancer, even if they were at stage IA [3]. Despite the great progresses that has been made in recent decades, the mechanism of lung cancer relapse and metastasis is not fully understood.

MiRNAs are a class of small, non-coding RNA that play important roles in various biological processes [4]. Bioinformatic methods predicted that in approximately one-third of all mammalian genes, especially those in down-stream of various signal transduction pathway, were targeted by miRNAs [5, 6]. Interestingly, accumulating evidence has implicated miRNAs in human cancer. Calin et al. revealed that 98 of 186 of miRNA genes located in cancer-associated genomic regions or in fragile sites and that down-regulation of miR-15 and miR-16 was frequently found in chronic lymphocytic leukemia [7, 8]. Additionally, altered expression of the let-7 and miR-155 in lung cancer correlated with the survival of patients [9, 10]. More recent studies in both in vitro and in vivo demonstrated that miR-10b initiated tumor invasion and metastasis in breast cancer [11]. In addition, miR-200c has been shown to influence E-cadherin expression and epithelial-to-mesenchymal transition, an essential early step in tumor metastasis [12]. However, the role of miRNAs in mediating tumor metastasis has been only recently investigated and still remains largely elusive.

In this study, we investigated the potential role of miRNA in invasion and metastasis of lung cancer. Through a screen with miRNA array, we identified miR-183 as a regulator of lung cancer metastasis. First, expression of miR-183 was found to be reversely correlated with the metastatic potential of lung cancer cells. In addition, ectopic expression of miR-183 in highly metastatic cells could inhibit cell migration and invasion. Consistent with its cellular function, miR-183 regulated the expression of many migration and invasion-related genes, including Ezrin, which has a role in controlling actin cytoskeleton, cell adhesion and motility. This has been well established. Together, our results strongly suggest that there is an important regulatory role of miR-183 in lung cancer metastasis, implying that it might be a useful diagnostic and prognostic marker of lung cancer.

2 Materials and methods

2.1 Cell culture

Paired high-metastatic human pulmonary giant cell carcinoma cell 801D, and low-metastatic human pulmonary giant cell carcinoma cell 95C were kindly provided by Professor Zhou Jianying (The 1st Affiliated Hospital, Medicine School, Zhejiang University, China) and grown in RPMI medium 1640 (Invitrogen, Carlsbad, CA) with 10% fetal bovine serum (Shanghai Sangon Biological Engineering Technology and Services Co., Ltd, Shanghai, China).

2.2 Isolation of total RNA

RNA was extracted by Trizol reagent (Invitrogen) as standard method.

2.3 MiRNA microarray

Small RNA separating, quality control, labeling, hybridization and scanning were performed by LC Sciences (Houston, TX, USA) using miRHuman_10.0_070802 miRNA array chip, based on Sanger miRBase Release 10.0. Preliminary statistical analysis was performed by LC sciences on raw data normalized by Locally-weighted Regression (LOWESS) method on the background-subtracted data. Then, Student's t test was performed to identify the different miRNA expression. MiRNAs with P < 0.01 was considered as having significant difference between 801D and 95C.

2.4 RT-PCR

MiR-183, VIL2, KRTAP3-2, and RUNX1T1 mRNA expression was measured by RT-PCR (details shown in Supplementary data).

2.5 Migration and invasion assay

We used the Transwell Insert (24-well Insert; pore size, 8 μm; Corning, USA) and wound healing experiment to explore the effect of miR-183 on migration and invasion of 801D cells (details shown in Supplementary data).

2.6 Growth inhibition and apoptosis test

Vybrant^® MTT Cell Proliferation Assay Kit (Invitrogen) and annexin V-FITC apoptosis detection kit (B.D. Biosciences Pharmingen, San Jose, CA USA) were employed to analyze cell growth and apoptosis respectively (details shown in Supplementary data).

2.7 Bioinformatics analysis

Three programs, PicTar, miRanda, and TargetScan [13-15], were used to predict the targets of miR-183.

2.8 Western blot

Ezrin protein was analyzed by Western blot using Ezrin Rabbit Monoclonal Antibody (Epitomics Inc., USA) (details shown in Supplementary data).

2.9 Plasmids construction and luciferase activities analysis

In order to construct plasmid pGL3-VIL2 3′ un-translated region (UTR) containing the binding site of miR-183, the following primers were used to amplify and clone the 3′ UTR of VIL2 gene into the pGL3-control vector (Promega) according to manufacturer's instructions: forward 5′ ATCGATGGTACCATGCTGGCCTGTGT GATAC3′; reverse 5′ CCGGGCAGATCTGAGCTCATTTCGAATACAGAAC 3′. Primers synthesizing and sequencing were fulfilled by Shanghai Sangon Biological Engineering Technology and Services Co. Ltd.

Forty-eight hours after transfection, luciferase activities were measured in Victor 1420 Multilabel Counter (Wallac, Finland) using Luciferase Assay System (Promega) according to the manufacturer's protocol.

2.10 GeneChip mRNA array and Gene ontology (GO) analysis

Affymetrix U133 plus 2 GeneChip (Affymetrix, Santa Clara, CA, USA) was used to explore the biological role of miR-183. 801D cells un-treated or transfected with miR-183 or negative control were harvested 36 h post-transfection. RNA isolating, quality control, labeling, hybridization, scanning, and data processing were performed by Genetimes Technology Inc. (Shanghai, China). Genes which fulfilled the cut-off criteria of a P value <0.05 and a linear fold change ⩾2 between groups were considered as having significant differences. GO analysis was performed using the GO-annotations downloaded from http://geneontology.org/.

2.11 Transfection

For miR-183 over-expression, 801D cells were transfected with the Pre-miRTM miRNA Precursor of miR-183 (Ambion Inc., USA) at 30 nmol/L final concentration using NeoFx (Ambion Inc.) and OPTI-MEM I Reduced-Serum Medium (Invitrogen). Efficiency of over-expression of miR-183 was measured by RT-PCR. Cy™3-labeled Pre-miR™ Negative Control#1 (Ambion Inc.) was used as negative control for miR-183 over-expression.

TransFast™ Transfection Reagent (Promega, Madison, USA) was used to transfect pGL3 plasmid with or without VIL2 3′ UTR into 801D cells according to the manufacturer's protocol.

2.12 Statistical methods

Differences between groups were compared using Pearson's chi-square test for qualitative variables and Student's t-test for continuous variables. P values <0.05 was considered significant.

3 Results

3.1 Reduced expression of miR-183 in 801D cell

To study the potential role of miRNA in lung cancer metastasis, we used the miRHuman_10.0_070802 miRNA array, which contained 711 probes, to scan miRNAs that were differentially expressed between paired high or low metastatic pulmonary giant cell cancer cells. In this study, 801D and 95C cell lines were chosen because they were originated from the same maternal cell line but displayed very dramatic differences in metastatic ability. Among 711 miRNAs screened, 92 miRNAs exhibited significantly different expression level between 801D and 95C cells (Supplementary Table 1). Of these potential candidates, we focused on miR-183 because it's one of the most obviously altered miRNAs and was deregulated in colorectal cancer with unclear function [16]. Consistent with the array results, RT-PCR further validated that miR-183 expression level in 801D was less than half of that in 95C (Fig. 1 ). Together, it suggested that expression level of miR-183 was inversely related to lung cancer metastasis.

Figure 1

MiR-183 was lowly expressed in 801D cells. RNA was isolated from different human pulmonary giant cell carcinoma cells, and miR-183 expression was analyzed by RT-PCR. The results represent the relative miR-183 level to un-treated 801D cells.

3.2 MiR-183 repressed cell migration and invasion in vitro

Cell migration and invasion are two essential processes in cancer metastasis. In accord with their metastatic potential, 801D displayed significantly higher migratory and invasive capability in vitro (data not shown). Thus, to explore the potential role of miR-183 in lung cancer metastasis, we first examined the consequence in cell motility and invasive capability after ectopic expression of miR-183 in 801D cells which had very low level of endogenous miR-183. Transwell Insert results showed that additional miR-183 significantly inhibited chemotaxis of 801D cells (Fig. 2 a). We then assayed the polarized migration of cells using scratch-wound model. As shown in Table 1 and Fig. 2b, cells transfected with miR-183 closed the scratch-wounds more slowly than cells un-treated or transfected with negative control. To examine the invasion capability, transfected or un-transfected 801D cells were plated on top of a layer of ECM extracted from mouse sarcoma. Cells that penetrated this barrier and reach the other side of the Transwell were recorded after 48 h of incubation. Consistent with the migration results, expression of miR-183 in 801D cells significantly inhibited their invasion (Fig. 2c). These differences appeared to be rooted in migration and invasion per se rather than defects in cell proliferation or cell death, as our MTT analysis found that miR-183 did not significantly influence viability of 801D cells (Fig. 3 a), and expression of miR-183 did not result in obvious apoptosis in 801D cells (Fig. 3b). Together, our results demonstrated that miR-183 played an inhibitory role in 801D cells migration and invasion in vitro.

Figure 2

Transwell Insert and wound healing assay showed that miR-183 negatively regulated cell migration and invasion in vitro. (a) After initial equilibrium, un-transfected or transfected with miR-183 or negative control 801D cells suspended in fresh medium without fetal bovine serum were added to the Insert. Forty-eight hours after seeding, the cells on the lower surface of the Insert were fixed and stained. Six visual field of each Insert were randomly counted under a microscope. The migratory cell number of 801D transfected with miR-183 was significantly less than that of 801D cells transfected with negative control. (b) Confluent cell monolayers were wounded with a pipette tip. Wound closure was monitored by microscopy at the indicated times. (c) For invasion assay, the Inserts were coated with ECM and then repeated as migration assay. The invasive cell number of 801D transfected with miR-183 was also significantly less than that of 801D cells transfected with negative control. Magnification in a, c, ×200, in c, ×100. (∗) = P < 0.005 compared to negative control transfected 801D cells.

Figure 3

MiR-183 had little effect on cell viability and apoptosis. (a) Cells were seeded in 96-well plates. MTT was added to each well for 3 h at 37 °C and then replaced by DMSO. Absorbance was read at 570 nmol/L. The data were presented as percentage of growth relative to that of un-treated 801D cells. (b) Seventy-two hours after transfection, the cells were harvested and stained with FITC-conjugated anti-annexin V antibody and PI. Stained cells were then quantified by FACSCalibur flow cytometry.

Table Table 1. MiR-183 over-expression significantly decreased wound healing capacity of 801D cells when compared with both un-treated 801D and 801D transfected with negative control. Data were described as closed width/scratched width (%, means &plusmn; S.D.).

Time point (hour)	0	6	12	24	36	48
801D	0 ± 0	14.15 ± 0.78	32.87 ± 1.74	85.97 ± 3.98	100 ± 0	100 ± 0
801D with miR-183	0 ± 0	13.48 ± 0.71	30.62 ± 1.37	67.30 ± 2.56 ⁎	76.50 ± 2.59 ⁎	100 ± 0
801D with negative control	0 ± 0	13.50 ± 1.58	31.57 ± 1.38	86.18 ± 3.97	99.78 ± 0.57	100 ± 0

• &#x204E; P &lt; 0.05, when compared with both 801D with negative control and 801D.

3.3 VIL2 was a target of miR-183

To further investigate the mechanism of miR-183 in lung cancer metastasis, we employed in silico analysis using three miRNA target prediction programs (TargetScan, PicTa'r and miRanda) [13-15]. Notably, all these databases predicted that VIL2, which contained the binding site of miR-183 in its 3′ UTR, could be regulated by miR-183 (Supplementary Fig. 1). Interestingly, previous works have demonstrated that expression of Ezrin expression was associated with tumor invasion and metastasis [17]. So, it is tempting to speculate that up-regulation of miR-183 might impair cell migration and invasion via down-regulation of Ezrin.

To test this hypothesis, we first examined Ezrin expression by Western blot. Our data showed that Ezrin expressed at a significantly higher level in 801D than in 95C (Fig. 4 a). Interestingly, after transfection with miR-183, Ezrin expression in 801D cell was almost abolished. In contrast, negative control RNA had little or none effect on Ezrin expression (Fig. 4a). However, RT-PCR showed that miR-183 expression could not decrease mRNA level of VIL2 (data not shown), suggesting that miR-183 regulated Ezrin expression at a post-transcriptional level.

Figure 4

MiR-183 directly suppressed VIL2. (a) Western blot showed that Ezrin expression was significantly higher in 801D cells than in 95C cells, and that, after transfection with miR-183, it was nearly disappeared. In contrast, negative control had little effect on Ezrin expression in 801D cells. β-Actin was used as positive control. (b) Luciferase activity measurement showed that when compared with co-transfection with pGL3-VIL2 and negative control, co-transfection with pGL3-VIL2 and miR-183 resulted in 2–3 fold decrease in 801D cells. In contrast, the luciferase activities of co-transfection with pGL3 vector and miR-183, co-transfection with pGL3 vector and negative control, and transfection with pGL3-VIL2 alone were similar to that of co-transfection with pGL3-VIL2 and negative control. The data were normalized to an internal control and each bar represented the mean value ± S.D. from three independent experiments. Empty pGL3-control vector was used as positive control. (∗) = P < 0.0001 compared to negative control transfected samples.

To further confirm VIL2 as a direct target of miR-183, the 3′ UTR of VIL2, containing binding site of miR-183, was fused with a luciferase reporter gene, and the resultant luciferase activities were examined. As expected, over-expression of miR-183 resulted in significant decrease in the luciferase activity (Fig. 4b). Thus, our data strongly suggested that VIL2 was a direct target of miR-183.

3.4 Microarray analysis revealed metastasis – associated genes whose expression changed in the presence of excess miR-183

To further explore the role of miR-183 in tumor metastasis, we performed microarray analysis using Affymetrix U133 plus 2 GeneChips to compare gene expression profiles among un-treated 801D cells and 801D cells transfected with ectopic expression of either miR-183 or negative control. Previous study demonstrated that miRNAs repression happened in a transient manner. For instance, CDK6, a confirmed target of let-7, was repressed at 36 h by let-7 but recovered to normal level by 72 h [18]. Thus, we harvested cells at 36 h post-transfection. With the criterion of a P value <0.05 and at least two-fold changes of expression level, we identified 424 (258 repressed and 166 up-regulated) genes that were differentially expressed (data not shown).

Genes, whose expression level was significantly altered, were grouped by their assigned biological functions using the GO database. Interestingly, we found that among the 424 miR-183-responding genes, 9.69% (25/258) of down-regulated genes and 7.23% (12/166) of up-regulated genes were functioning in cell adhesion, migration, invasion, and/or metastasis (Supplementary Table 2), including: CCL5, which enhanced motility, invasion, and metastasis of breast cancer cells through the chemokine receptor CCR5 [19]; CTHRC1, which promoted melanoma cells migration and were aberrant in human solid cancers [20]; CYR61[21] and various adhesion, migration, invasion and angiogenesis–associated proteins. RT-PCR verified that the mRNA level of KRTAP3-2and RUNX1T1, the most obviously miR-183-responding genes, could be down-regulated by over-expression of miR-183 (data not shown), implying that miR-183 did regulate KRTAP3-2and RUNX1T1 expression. Taken together, our results identified a group of metastasis-related genes whose expression was regulated by miR-183, further supporting the potential role of miR-183 in cancer metastasis.

4 Discussion

The malignant progression of a tumor from benign to invasive and metastatic is usually associated with a poor prognosis for cancer patients. Tumor metastasis is a highly complex and multistep process that includes altered cell adhesion, survival, proteolysis, migration, lymph/angiogenesis, immune escape, and homing on target organs. Cell motility and invasion are essential features of the metastatic process, and the identification and characterization of molecules and their associated pathways that control cell motility and invasion are critical to our understanding of cancer metastasis. Recently, emerging evidence has implicated miRNA in metastasis of human cancer [11, 12].

To identify potential miRNA involved in lung cancer metastasis, we profiled miRNAs expression in paired high and low metastatic cells originated from pulmonary giant cell cancer, which is a specific type of lung cancer characterized by more progressive clinical behavior. Interestingly, 92 of 711 assayed miRNAs displayed significantly differential expression levels (Supplementary Table 1). Among these 92 potential targets, some miRNAs have been previously demonstrated to be involved in tumor [9, 10, 12]. Our miRNA profiling revealed a 2–3 fold decrease of miR-183 in highly metastatic lung cancer cells versus non-metastatic counterparts derived from same parental cell lines. We further utilized multiple cell-culture based approaches to establish the inhibitory role of miR-183 in motility and invasion of lung cancer cell.

Using both in-silico analysis and mRNA profiling, we identified several potential down-stream effectors of miR183, including Ezrin. Ezrin has been well recognized as a molecular linker between actin cytoskeleton and plasma membrane, and has been involved in the maintenance of cyto-morphology, cell adhesion, and cell movement [17]. Thus, it is conceivable that Ezrin might contribute to the regulation of metastasis by miR-183. Interestingly, among 424 changed genes that we identified by mRNA microarray, more than 30 genes were also involved in metastasis. Their cellular functions encompass regulation of extracellular matrix, cell adhesion, and cytoskeletal regulation. Further study would be required to fully understand their role in miR-183 regulation of lung cancer metastasis.

Interestingly, in addition to repress metastasis-promoting genes expression, miR-183 also decreased metastasis-suppressing genes mRNA level, such as WISP2, which decreased breast tumor cells migration and invasion [22], and increased metastasis-promoting genes expression, such as S100P, which promoted metastasis of prostate cancer cell [23]. Its mechanism and significance remained to be further determined. Indeed, the same miRNA, for example let-7, could act not only as oncogene, but also as tumor suppress gene in different cancer cell [24, 25].

Emerging evidence started to reveal the diverse and profound role of various miRNA in regulating tumor metastasis. Interestingly, in addition to miR-183, our profiling results also showed changes in expression levels of many other miRNA, such as miR-574 family & miR-29 family. Further study would be required to fully understand the role of each individual miRNA candidate in metastasis. When our paper was about to be finished, there were other studies published, which identified miR-126, miR-335, miR-373, miR-520c, miRNA-200 family and miR-205 as tumor metastasis-associated miRNAs, further supporting that miRNAs might be involved in tumor metastasis [26-28].

In conclusion, our results identified miR-183 as a new molecular target involved in lung cancer metastasis, and shed mechanistic insight into its role in cell migration and invasion. Our work might provide an important avenue for developing new diagnostic and therapeutic targets for the treatment of metastatic lung cancer.

Acknowledgement

This work was supported by National Basic Research Program of China–973 Program (2004CB518707) and Science Research 332 Fund, Ministry of Health of the People's Republic of China 333 (WKJ2007-2-003).

Appendix A A

Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.febslet.2008.09.051.